• Home
• Graduate Program
• Research Programs
  • Research Overview
  • Centers and Programs
  • Training Grants
  • Grant Funding
• Seminar Series
• Faculty
  • Faculty Summary
  • Charles E. Wood, Ph.D.
  • Chris Baylis, Ph.D.
  • A. J. Cardounel, Ph.D.
  • Kirk P. Conrad, M.D.
  • Judy M. Delp, Ph.D.
  • George A. Gerencser, Ph.D.
  • Hideko Kasahara, M.D., Ph.D.
  • S. Paul Oh, Ph.D.
  • Mohan K. Raizada, Ph.D.
  • Peter P. Sayeski, Ph.D.
  • Debbie A. Scheuer, Ph.D.
  • Bruce R. Stevens, Ph.D.
  • Colin Sumners, Ph.D.
  • Glenn A. Walter, Ph.D.
  • Emeritus Faculty
  • Adjunct Faculty
• Internal Forms
• Contact Us
  • Departmental Office
  • Administrative Staff
  • Postdoctoral Associates and Fellows
  • Graduate Students
  • Lab Staff

Bruce R. Stevens, Ph.D.

Professor

Bruce R. Stevens, Ph.D.

(352) 392-4480
Office: CG-20C
stevensb@ufl.edu
PubMed Listing
Biosketch

Research Interests

Research in my laboratory centers on the cellular physiology, molecular biology, and regulation of organic solute transport across plasma membranes. Current research projects concern cytokine and peptide growth factor regulation of membrane L-arginine transporter isoforms in lymphocytes, cultured brain glial and neuronal cells, and cultured intestinal adenocarcinoma cells. Other projects concern the regulation of transporters and membrane-bound enzymes by specific nutrients. Using radiation inactivation by a 13-MeV linear accelerator, we are collaborating in investigating the molecular arrangement of membrane-bound transporter polypeptides and putative regulatory subunits. The cloning of specific transporters and the mechanism by which the polypeptides behave in membranes is being studied using electrophysiological techniques in oocytes injected with cRNA. An additional project in collaboration with NASA concerns myosin isoforms and the intermediary metabolism of amino acids in exercising skeletal muscle.

Eh codon usage: catgaaatcaaagaacacatt

Publications

• Search PubMed (does not include book chapters nor review papers nor meeting abstracts) [Search]

Patents

• U.S. Patent No. 6,100,287: “Materials and methods for enhancing muscle performance and recovery from fatigue.” [Details]
• U.S. Patent No. 6,766,613: “Materials and methods for controlling pests.” [Details]
• U.S. Patent No. 7,181,884: “Materials and methods for controlling medical insect vector pests.” [Details]

University Appointments

• Professor (primary appointment), College of Medicine, Department of Physiology & Functional Genomics
• Course Director, Medical Physiology
• Director, Program in Schizophrenia & Related Conditions, University of Florida
• Faculty, McKnight Brain Institute of University of Florida
• Professor (affiliate), Center for Exercise Science, College of Health & Human Performance
• Professor (affiliate), Department of Surgery, College of Medicine
• Collaborator, The Whitney Laboratory of the University of Florida
• Professor (affilate), Department of Entomology & Nematology, University of Florida
• Medical Student Teaching
• Physician Assistant Student Teaching
• Dental Student Teaching